KAIJU Bio, Inc.

AI guided nucleic acid targeting and molecular delivery.

KAIJU Bio is building a software enabled biotechnology platform for discovering programmable nucleic acid based targeting systems and precision molecular delivery technologies against biological targets that remain difficult for conventional modalities. Our goal is to enable the next generation of in vivo medicines by connecting model guided design, human cell screening, and experimentally grounded learning loops.

ATGCCGTACGATTCGACGTAAGCTTAGCGTACCGATTCGATACGGACCTAG CGTAACTGGCATTCGATCGGATACCGTTAAGCTGACCTGATCGTACGATCA TGCACATGGCTAATCGCTAAGTGCATTCGGATCGTACGTACCGTTAGCTTA GGATTACGCCTAAGCTTATGCTGAATCGTCAACGATCGTAGGCTTACCGTA ACGTTAGCGATCCGTAGCTACCGTTAACGATGCTAGTCCATGACGATTCG TCGATCGGCTAAGTTCGACGATACCTGACGTTACGATGCACCTAGTACGGA CATGGCATTCGACTAGGCTAACCGTACGATTCGGTACGAACGTTACGATC GCTTAACGATCGTACCTGATTCGACGTAACCGTTAAGCATCGGATCCGTAA TACGATTCGGCATACCGTTAGCATCGATCGTACGACTGGATTCGCATACGT CGATACCTGACGTTACCGATTCGATCGTAGCTTAACGGCATTCGTACCGAT ATTCGACGGTACCGTTAAGCTGACCATGGCATTCGACTAGGCTAAGCTGAC GGTACGAACGTTACGATCCGTAGCTACCGTTAACGATGCTAGTCCAGTACG CCGATTCGTAACGATGCTTAGCCGTACGATTCGACCTAGTACGGTTAAGCA TTAACGATCGTACCGGATTCGACGTAAGCTTAGCATGGCATTCGACTAGGC GATCGTAGGCTTAACCGTACGATTCGGCATACCGTTAGCATCGATCGTAC ACCTGACGTTACGATGCACCTAGTACGGATTCGACGGTACCGTTAAGCTA CGTACTGATTCGACGTAACCGTTAAGCATCGGATCCGTAACTGGCATTCG TGCATTCGGATCGTACGTACCGTTAGCTTACCGATTCGATCGTAGCTTAA GACGTAAGCTTAGCGTACCGATTCGATACGGACCTAGCATGGCATTCGAC CTGACCATGGCATTCGACTAGGCTAAGCTGACGTTACCGATTCGATCGTA

Platform thesis

Closed loop discovery for programmable molecular targeting.

KAIJU Bio is developing a design-build-screen-learn loop for sequence defined targeting systems, connecting model guided library design with experimental feedback so recognition, delivery, and biological context can be optimized in tandem. Behind the platform is proprietary infrastructure for connecting sequence design, synthesis planning, screening data, and model refinement across design cycles.

Design

Model guided generation

Generate sequence defined targeting systems across vast design spaces where recognition, delivery, and biological context can be explored in tandem in physiologically relevant systems.

Build

Scalable design and synthesis

Connect nucleic acid design and synthesis workflows for ultra-large experimental search spaces informed by human biology.

Screen

Human cell functional screening

Measure targeting and delivery behavior in disease relevant human cellular contexts where functional signal is observed directly through parallelized multiplexed readouts.

Learn

Experimental feedback loops

Use functional data to refine candidate selection and improve subsequent design cycles.

Technology

Delivery systems for complex biological context.

KAIJU's delivery work applies AI enabled screening at massive scale to explore broad distributions of peptide nanoparticle designs and molecular delivery behaviors. Rather than optimizing a single component in isolation, the platform is built to evaluate how targeting, formulation, biodistribution, and biological context interact across multiplexed experimental systems.

This distributional approach is designed to surface delivery architectures that perform in complex in vivo environments, where context, cell state, and tissue exposure shape therapeutic activity.

Programmable nucleic acid recognition

Model guided exploration of molecular systems for recognition of challenging biological targets and cellular contexts.

Precision molecular delivery

AI enabled screening at massive scale explores broad distributions of peptide nanoparticle designs and delivery behaviors.

Human cell functional screening

Human cell systems and multiplexed readouts help evaluate how biological context shapes functional delivery signal.

Candidate ranking and model refinement

Experimental data informs candidate ranking and subsequent design cycles, allowing the platform to refine molecular systems based on measured function rather than design assumptions alone.

Why now

Biological design, synthesis, human cell screening, and cloud scale modeling are converging.

The next generation of in vivo medicines will require targeting and delivery systems that can be discovered, optimized, and validated together, not treated as separate problems. KAIJU is building for that convergence: sequence defined design, screening that captures cellular behavior, and models that learn from each experimental cycle.

Scientific foundation

Generative models for biological sequence design.

KAIJU's scientific foundation builds on work in generative models for large scale biological sequence design and synthesis.

KAIJU is translating core scientific insights from large scale biological sequence design into proprietary discovery infrastructure for nucleic acid recognition systems and precision molecular delivery. Our work applies these principles toward next generation in vivo medicines, extending them into targeting and delivery challenges.

Example here

Ecosystem